| Detail of Probeset 258977_s_at in Chip ATH1 | |
| Probeset ID | 258977_s_at |
| Species | Arabidopsis thaliana |
| Annotation | putative aspartate kinase similar to aspartate kinase GB:CAA67376 (Arabidopsis thaliana); supported by full-length cDNA: Ceres: 6203. |
| Mapped public sequence ID | At3g02020 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ctgctccaggaactgtcatcaccagatcaagagacatgagcaaggctgtattgaccagca |