| Detail of Probeset 259130_at in Chip ATH1 | |
| Probeset ID | 259130_at |
| Species | Arabidopsis thaliana |
| Annotation | putative ribosomal protein L39 similar to ribosomal protein L39 GB:P51424 [Arabidopsis thaliana];supported by full-length cDNA: Ceres:946. |
| Mapped public sequence ID | At3g02190 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gtcgcacaagtcgttcatgatcaaaaagaagctagggaagaagatgagacagaacagacc |