| Detail of Probeset 259288_at in Chip ATH1 | |
| Probeset ID | 259288_at |
| Species | Arabidopsis thaliana |
| Annotation | putative small nuclear ribonucleoprotein polypeptide G similar to small nuclear ribonucleoprotein polypeptide G GB:4507133 [Homo sapiens] |
| Mapped public sequence ID | At3g11500 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gtcagcctccagatctcaagaagtacatggacaagaaactccaaattaagcttaatgcca |