| Detail of Probeset 259457_at in Chip ATH1 |
| Probeset ID |
259457_at |
| Species |
Arabidopsis thaliana |
| Annotation |
auxin response factor 1, putative similar to auxin response factor 1 GI:2245378 from [Arabidopsis thaliana], non-consensus TT donor splice site at exon 5 |
| Mapped public sequence ID |
At1g43950 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
agatacaagcgctcaaggtgaattctctgttccatgtaaacatgccattgaatgtctccc
tccgctggatatgtctcaacctataccggcacaagaacttattgctatagatctccatgg
taatcaatggagattcaaacacagctatagagtaccccgcggagacacaactggttggaa
t |
