| Detail of Probeset 260257_at in Chip ATH1 |
| Probeset ID |
260257_at |
| Species |
Arabidopsis thaliana |
| Annotation |
putative dolichyl-phosphate mannosyltransferase polypeptide 2 similar to dolichyl-phosphate mannosyltransferase polypeptide 2 GB:4503365 (Homo sapiens) (regulator of dolichol phosphate-mannose synthesis: EMBO J 1998 Sep 1;17(17):4920-9) |
| Mapped public sequence ID |
At1g74340 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttagcggatcgagcagtcgggcttctactatcttcaatcagcttgtccatattcacgtac
tatactttttgggtcatcatcctgccatttgtagatagtgatcacttcatccacaagtac
ttcttaccccaagactatgccattctcgtacctgtctttgccggcatagctcttctctct
ctcatttccgtattcatcggcatggtcatgctc |
