| Detail of Probeset 261489_at in Chip ATH1 | |
| Probeset ID | 261489_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein contains similarity to cytochrome c oxidase subunit I GI:5678701 from [Loligo pealei]; supported by full-length cDNA: Ceres: 314. |
| Mapped public sequence ID | At1g14450 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tggcgaagcctttgggaacaaccggcgaatttttccggcgaagagatgaatggaggaagc |