| Detail of Probeset 262569_at in Chip ATH1 | |
| Probeset ID | 262569_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein Strong similarity to gi|4734005 F3L12.7 hypothetical protein from Arabidopsis thaliana BAC gb|AC007178; supported by cDNA: gi_15028308_gb_AY045957.1_ |
| Mapped public sequence ID | At1g15180 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gtctgtctccaaacaactgcgacagtctattcgatacatcttgcaatcgcagctgcagca |