| Detail of Probeset 262593_at in Chip ATH1 |
| Probeset ID |
262593_at |
| Species |
Arabidopsis thaliana |
| Annotation |
putative ubiquinol--cytochrome-c reductase Similar to gb|X79273 cytochrome c reductase hinge protein subunit from Solanum tuberosum. ESTs gb|T45282 and gb|T21596 come from this gene;supported by full-length cDNA: Ceres:19178. |
| Mapped public sequence ID |
At1g15120 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gttgatccaaagaagtaccttgaggaatcttgcaaaccaaaatgtgtgaagccacttctc
gaatatcaggcatgtgtcaagagaatccaaggtgatgattctggccacaagcattgcact
ggccagtattttgactactggcaatgcattgacaaatgtgttgcaccaaagctgtttgcg
aaac |
