| Detail of Probeset 262684_s_at in Chip ATH1 | |
| Probeset ID | 262684_s_at |
| Species | Arabidopsis thaliana |
| Annotation | vacuolar ATP synthase subunit B identical to vacuolar ATP synthase subunit B SP:P11574 [P11574]; supported by cDNA: gi_166626_gb_J04185.1_ATHATPASE |
| Mapped public sequence ID | At1g76030 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | actatgcccaatgacgatatcactcatccaactccggatcttactggttacattactgaa |