| Detail of Probeset 262985_s_at in Chip ATH1 | |
| Probeset ID | 262985_s_at |
| Species | Arabidopsis thaliana |
| Annotation | 60s ribosomal protein l27a. similar to 60S RIBOSOMAL PROTEIN L27A GB:P49637 GI:1710530 from [Arabidopsis thaliana];supported by full-length cDNA: Ceres:23092. |
| Mapped public sequence ID | At1g23290 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | aagaagagaggtcacgtcagcgccggacatggacgtatcggtaagcaccgtaagcatccc |