| Detail of Probeset 263665_at in Chip ATH1 | |
| Probeset ID | 263665_at |
| Species | Arabidopsis thaliana |
| Annotation | putative putative 60S ribosomal protein L17 identical to GB:AAB80655; supported by full-length cDNA: Ceres: 4513. |
| Mapped public sequence ID | At1g04480 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gagggcgtggaggtacctctggtaacaaattcaggatgtcactgggtcttccggtggcgg |