| Detail of Probeset 264074_at in Chip ATH1 | |
| Probeset ID | 264074_at |
| Species | Arabidopsis thaliana |
| Annotation | putative retroelement pol polyprotein related to retroelement del1-46 from Lilium henryi (GB:226407) and a retroelement from Ananas comosus (GB:Y12432); Contains a CCHC-type zinc-finger domain and a reverse transcriptase domain |
| Mapped public sequence ID | At2g10780 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tgtggaattgtagaggccgtgaggaatacacttg |