| Detail of Probeset 264189_s_at in Chip ATH1 | |
| Probeset ID | 264189_s_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein similar to acyl-carrier protein (ACP) GI:17768 from [Brassica napus]; supported by full-length cDNA: Ceres: 1822. |
| Mapped public sequence ID | At1g54630 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ctgcgctgcaaaacctgagacagtggacaaggtgtgtgcagttgtcagaaagcaactctc |