| Detail of Probeset 264196_at in Chip ATH1 | |
| Probeset ID | 264196_at |
| Species | Arabidopsis thaliana |
| Annotation | putative RING zinc finger protein Contains similarity to RING zinc finger protein gb|X95455 from Gallus gallus |
| Mapped public sequence ID | At1g22670 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | acaacactacaggtttctcttgcgctatctgccttgaagactacattgttggagacaagc |