| Detail of Probeset 264727_at in Chip ATH1 | |
| Probeset ID | 264727_at |
| Species | Arabidopsis thaliana |
| Annotation | putative cytochrome C strong similarity to GB:P00050 and GB:CAB39628; supported by full-length cDNA: Ceres: 31770. |
| Mapped public sequence ID | At1g22840 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tggcgtcgtttgatgaagcaccaccaggaaacgccaaggccggtgagaagatcttcagga |