| Detail of Probeset 264817_at in Chip ATH1 | |
| Probeset ID | 264817_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein similar to membrane associated salt inducible protein isolog; similar to F21B7.16 and F21B7.21 |
| Mapped public sequence ID | At1g03540 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gggtgcattgattctgctagtcgtgtttactccaagatgtcaattaggaacatgataacg |