| Detail of Probeset 265035_at in Chip ATH1 | |
| Probeset ID | 265035_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein contains Pfam profile: PF01363 FYVE zinc finger; supported by full-length cDNA: Ceres: 15739. |
| Mapped public sequence ID | At1g61620 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | agtgcaatgcctcgaaacagtgacaagaatcacaacgaagataagaatggttttcatggg |