| Detail of Probeset 265193_at in Chip ATH1 | |
| Probeset ID | 265193_at |
| Species | Arabidopsis thaliana |
| Annotation | unknown protein ESTs gb|T144077 and gb|T43352 come from this gene; supported by full-length cDNA: Ceres: 13725. |
| Mapped public sequence ID | At1g05070 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gacacacggcggcgctgaagatcgggctagctttactggggctgagcatggctggttaca |