| Detail of Probeset 265555_at in Chip ATH1 | |
| Probeset ID | 265555_at |
| Species | Arabidopsis thaliana |
| Annotation | putative Mutator-like transposase related to the MURA transposase of the Mutator transposable element family of maize |
| Mapped public sequence ID | At2g07500 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tatagctcctgacaatcctgatttattttttatatctgacagacatggtagcatatacac |