| Detail of Probeset 266056_at in Chip ATH1 | |
| Probeset ID | 266056_at |
| Species | Arabidopsis thaliana |
| Annotation | hypothetical protein predicted by genscan; similar to sp P43601 YFJ1 YEAST; similar to sp P50079 YG4Q YEAST |
| Mapped public sequence ID | At2g40810 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gtattgcgtgtatgaccttgacattggatggtttgttgcttgcaactgctagtacaaagg |