| Detail of Probeset 266060_at in Chip ATH1 | |
| Probeset ID | 266060_at |
| Species | Arabidopsis thaliana |
| Annotation | unknown protein unusual splice site at second intron; GA instead of conserved GT at donor site |
| Mapped public sequence ID | At2g18630 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tgtttgtgactgcgtttgtctctgtgcttatcttctcggtggttgcagccgctgtggctg |