| Detail of Probeset 266253_at in Chip ATH1 | |
| Probeset ID | 266253_at |
| Species | Arabidopsis thaliana |
| Annotation | unknown protein contains non-consensus donor splice site AT at exon2 and acceptor splice site AC at exon3. |
| Mapped public sequence ID | At2g27840 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ggttacccttggtgacgttgagaaggttaaaaaagatgagacttttgccgtttatgtgaa |