| Detail of Probeset 267002_s_at in Chip ATH1 | |
| Probeset ID | 267002_s_at |
| Species | Arabidopsis thaliana |
| Annotation | putative photosystem II type I chlorophyll a b binding protein. ; supported by full-length cDNA: Ceres: 23727. |
| Mapped public sequence ID | At2g34430 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gttttccctgagctattggctaggaacggagtgaagttcggagaagcggtttggttcaag |