| Detail of Probeset 267026_at in Chip ATH1 | |
| Probeset ID | 267026_at |
| Species | Arabidopsis thaliana |
| Annotation | DREB-like AP2 domain transcription factor DRE binding proteins may be involved in dehydration or low temp response |
| Mapped public sequence ID | At2g38340 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gagaatcctgtttgtcggtttagaggtgttcgacaaagggtttgggggaaatgggttgct |