| Detail of Probeset AFFX-Msa-ubq11-3_at in Chip AffyMedicago |
| Probeset ID |
AFFX-Msa-ubq11-3_at |
| Species |
Medicago sativa |
| Annotation |
M. sativa /GEN=ubq11 /DB_XREF=iMsa.2958 /FEA=mRNA /DEF=ubq11 |
| Mapped public sequence ID |
TC169 |
| Gene Ontology |
GO:0000209 GO:0003674 GO:0005575 GO:0005737 GO:0006513 GO:0006950 GO:0016567 GO:0016579 GO:0030437 GO:0031386 GO:0043008 |
| KEGG |
K08770 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS40199 EX523044
|
| Target sequence |
cgaggacggccgcacccttgctgactacaacatccagaaggaatctacccttcatcttgt
cctccgtctacgtggtggtatgcagatcttcgtcaagaccctcaccgggcagaccatcac
ccttgaggtggaaagctctgacaccattgacaatg |