| Detail of Probeset AFFX-Mtr-r2-Ec-bioB-3_at in Chip AffyMedicago |
| Probeset ID |
AFFX-Mtr-r2-Ec-bioB-3_at |
| Species |
Medicago sativa |
| Annotation |
E. coli /GEN=bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2772-3004 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiot |
| Mapped public sequence ID |
AFFX-Mtr-r2-Ec-bioB-3 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tcttacgtgcgcctttctgccggacgcgagcagatgaacgaacagactcaggcgatgtgc
tttatggcaggcgcaaactcgattttctacggttgcaaactgctgaccacgccgaatccg
gaagaagataaagacctgcaactgttccgcaaactgg |