| Detail of Probeset Msa.1189.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1189.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1189 /TID=Msa.1189.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | gi|50318266|gb|CO513392.1|CO513392 |
| Gene Ontology | GO:0003746 GO:0005515 GO:0005634 GO:0005737 GO:0005829 GO:0005853 GO:0006414 GO:0006916 |
| KEGG | K03231 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40768 TCMT42229 BQ156704 BE942340 |
| Target sequence | ggttgagacctttgctgaatatcctccacttggacgttttgctgtcagggacatgcgtca |