| Detail of Probeset Msa.1611.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1611.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1611 /TID=Msa.1611.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC183 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0005739 GO:0005743 GO:0005750 GO:0008150 GO:0032403 |
| KEGG | K00417 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41022 TCMT43422 BG580689 BM779896 |
| Target sequence | caatggcgtctttgctacaagcgattgtagatccaaagaaaaactggttcgctgctcaac |