| Detail of Probeset Msa.1701.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1701.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1701 /TID=Msa.1701.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC471 |
| Gene Ontology | GO:0004672 GO:0005524 GO:0005575 GO:0006468 GO:0007242 GO:0051219 |
| KEGG | K04418 K04424 K04427 |
| Transporter | 1.A.1 1.A.1.4.4 1.A.1.4.5 |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | AF458700 DY615441 TCMT56384 |
| Target sequence | gtggatgcgtattcttttggtctcattgtatatgagatgatagaaggtataccgcccttc |