| Detail of Probeset Msa.1715.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Msa.1715.1.S1_s_at |
| Species | Medicago sativa |
| Annotation | iMsa.1715 /TID=Msa.1715.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC50 |
| Gene Ontology | GO:0004601 GO:0020037 GO:0009533 GO:0009535 GO:0016688 |
| KEGG | K00430 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40936 TCMS40937 EX524698 EX525569 CO515740 EX524339 |
| Target sequence | gagcacacagtgttggtagaacccattgtacaaagttggtgcaccgtttgtaccccgaag |