| Detail of Probeset Msa.1716.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1716.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1716 /TID=Msa.1716.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC501 |
| Gene Ontology | GO:0004512 GO:0005575 GO:0005737 GO:0006021 GO:0008654 GO:0000910 GO:0004222 GO:0006508 GO:0016887 |
| KEGG | K01858 K03798 |
| Transporter | 3.A.16.1.1 3.A.16.1.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40191 TCMS40186 TCMT46349 |
| Target sequence | gtgagcctgaggttacaactggtgcaggcggtgatttgcagcaaatcaccggtatagcaa |