| Detail of Probeset Msa.1867.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1867.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1867 /TID=Msa.1867.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC105 |
| Gene Ontology | GO:0005372 GO:0005887 GO:0006833 GO:0007588 GO:0005515 GO:0005902 GO:0015250 GO:0016323 |
| KEGG | K09872 |
| Transporter | 1.A.8 1.A.8.11.1 1.A.8.11.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40205 TCMT42706 BQ156884 |
| Target sequence | gttggtacctttgttcttgtctacaccgtcttctccgccactgatgccaagcgtagcgcc |