| Detail of Probeset Msa.1900.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Msa.1900.1.S1_at |
| Species |
Medicago sativa |
| Annotation |
iMsa.1900 /TID=Msa.1900.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID |
TC336 |
| Gene Ontology |
GO:0000187 GO:0000303 GO:0001541 GO:0001819 GO:0001895 GO:0002262 GO:0004784 GO:0005507 GO:0005515 GO:0005615 GO:0005634 GO:0005737 GO:0005739 GO:0005829 GO:0005886 GO:0006302 GO:0006309 GO:0006749 GO:0006801 GO:0006879 GO:0006979 GO:0007283 GO:0007566 GO:0007568 GO:0007569 GO:0007605 GO:0007626 GO:0008217 GO:0008270 GO:0008340 GO:0009408 GO:0010033 GO:0016209 GO:0019226 GO:0019430 GO:0030346 GO:0031012 GO:0031410 GO:0032287 GO:0032839 GO:0040014 GO:0042493 GO:0042542 GO:0043025 GO:0043085 GO:0043234 GO:0043524 GO:0045471 GO:0045541 GO:0045859 GO:0046716 GO:0048678 GO:0050665 GO:0051087 GO:0051881 GO:0060047 GO:0060052 GO:0060087 GO:0060088 |
| KEGG |
K04565 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS41027 TCMT49485
|
| Target sequence |
ggtactattagcttctctcaggagggaaatggtccaaccactgtgactggaaatctttct
ggtcttaagcctggcctccatggcttccatatccatgccttgggggacaccacaaatggt
tgcatgtcaactggaccacatttcaatcctaatggtaaggagcacggtgcccctgaggat
gagactcgacatgctggtgatttaggaaatgtcactgtcggtgatgatggaaccgcaagc
ttcaccattactgac |