| Detail of Probeset Msa.1956.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.1956.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.1956 /TID=Msa.1956.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC745 |
| Gene Ontology | GO:0001764 GO:0005515 GO:0005575 GO:0005739 GO:0006605 GO:0007165 GO:0008150 GO:0008426 GO:0019899 GO:0019904 GO:0021766 GO:0021987 GO:0035308 |
| KEGG | K06630 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40817 TCMT42050 EX530426 |
| Target sequence | gaggattctgtcttccattgagcaaaaggaggagactaaaggaaatgatgtgaatgcgaa |