| Detail of Probeset Msa.1963.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Msa.1963.1.S1_s_at |
| Species | Medicago sativa |
| Annotation | iMsa.1963 /TID=Msa.1963.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC85 |
| Gene Ontology | GO:0005509 GO:0005575 GO:0000331 GO:0000910 GO:0031013 GO:0032781 GO:0043549 GO:0051343 |
| KEGG | K02183 |
| Transporter | 1.A.20 2.A.29 1.A.20.2.1 2.A.29.23.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40702 TCMS40701 TCMT42291 |
| Target sequence | aacagagactcttctatttctcaggtcatggatgaagaagaagttcgcaagatcttcaac |