| Detail of Probeset Msa.2699.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.2699.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.2699 /TID=Msa.2699.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | gi|50318330|gb|CO513456.1|CO513456 |
| Gene Ontology | GO:0003723 GO:0003735 GO:0005515 GO:0005737 GO:0005829 GO:0006414 GO:0022627 |
| KEGG | K02969 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO513456 AW683940 TCMT42757 EY474036 |
| Target sequence | tagcagcttgcagattcttcttcaccgccgtcaatttccatcacggaagaaaaagcacac |