| Detail of Probeset Msa.2936.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.2936.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.2936 /TID=Msa.2936.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC1 |
| Gene Ontology | GO:0005215 GO:0005575 GO:0006869 GO:0008289 GO:0050830 GO:0050832 |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40008 TCMS40006 EX521976 EX521974 EX524307 EX522011 EX524725 |
| Target sequence | gcaatctcatgtggaacagtaactggtgctctttctccatgcattgcatatcttagaggt |