| Detail of Probeset Msa.3038.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Msa.3038.1.S1_at |
| Species | Medicago sativa |
| Annotation | iMsa.3038 /TID=Msa.3038.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID | TC533 |
| Gene Ontology | GO:0005215 GO:0005315 GO:0005384 GO:0005887 GO:0006797 GO:0006810 GO:0006817 GO:0006828 GO:0006944 GO:0009451 GO:0016021 GO:0016072 GO:0042254 |
| KEGG | K08176 |
| Transporter | 2.A.1 2.A.1.9 2.A.1.9.2 2.A.1.9.3 2.A.1.9.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40628 TCMT55784 TCMT55783 |
| Target sequence | ttattgcgctgtgcagtactgttccgggttactggttcacagtagcgtttatcgatcaca |