| Detail of Probeset Msa.3178.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Msa.3178.1.S1_s_at |
| Species |
Medicago sativa |
| Annotation |
iMsa.3178 /TID=Msa.3178.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF= |
| Mapped public sequence ID |
TC630 |
| Gene Ontology |
GO:0003746 GO:0003747 GO:0005085 GO:0005811 GO:0005829 GO:0005853 GO:0006414 GO:0003785 GO:0005737 GO:0005938 GO:0030041 GO:0045335 |
| KEGG |
K03232 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CO516531 TCMT40600
AA660278 |
| Target sequence |
gcaggagcacctgctaaagctgctgcacctgctgctgaagatgatgatgatcttgacctc
tttggtgatgaaacagaggaggataagaaggcagcagaggaaagggaggcatctaaaaag
cccgcaaagaaagaaagagagtggcaagtcttccattctgcttgatgttaa |