Detail of Probeset Msa.876.1.S1_at in Chip AffyMedicago
Probeset ID Msa.876.1.S1_at
Species Medicago sativa
Annotation iMsa.876 /TID=Msa.876.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF=
Mapped public sequence ID gi|11094360|gb|AF196284.1|AF196284
Gene Ontology GO:0000003 GO:0000910 GO:0002119 GO:0005515 GO:0007052 GO:0009792 GO:0018985 GO:0018996 GO:0040026 GO:0051229 GO:0051299 GO:0000159 GO:0004722 GO:0005737 GO:0005829 GO:0005886 GO:0006470 GO:0007498 GO:0008022 GO:0046982
KEGG K04382
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database AF196284  TCMT53914  
Target sequence acgtggtgctggatacacatttgggcaggatatagcttctcagttcaatcataccaatgg
cctctccctcatatctagagctcaccagcttgttatggaaggatacaattgggctcagga
gaagaacgtggtcactgtatttagt