| Detail of Probeset Mtr.1018.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.1018.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1510.m00025 /FEA=mRNA /DEF=AC124962.19 18629 15404 mth2-24d19 weakly similar to UP|GON1_ARATH (Q941R4) GDP-mannose transporter |
| Mapped public sequence ID |
1510.m00025 |
| Gene Ontology |
GO:0005338 GO:0005458 GO:0005794 GO:0006486 GO:0015780 GO:0015784 GO:0030448 GO:0003674 GO:0005575 GO:0008150 |
| KEGG |
K11707 K18051 |
| Transporter |
2.A.7 2.A.7.13 2.A.7.13.1 2.A.7.13.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BE941082 |
| Target sequence |
gccacttctgagattacctagcttttggttagtgatgaccttcagtggagttttgggtct
agcaattagcttcacctccatgtggtttcttcatcaaacaggggctacaacttacagtaa
atcttgtacaagtttgtgttacgttcttgattcaatgctaaaggtagaaatgcaaattgc
agggcttttggcaggagtacttttcgctagagccaaaatccgggag |
