| Detail of Probeset Mtr.10297.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.10297.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106311 /FEA=mRNA /DEF=similar to UP|Q41119 (Q41119) Cyclophilin , complete |
| Mapped public sequence ID | TC106311 |
| Gene Ontology | GO:0003755 GO:0005739 GO:0005759 GO:0016018 GO:0045069 GO:0006457 GO:0009792 GO:0030587 |
| KEGG | K01802 K03767 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO514106 TCMS40566 TCMT42466 TCMT42516 BQ158249 BQ158326 BQ145023 |
| Target sequence | tttcatcaagaagcacaccggtcctggaatcctctccatggcaaacgctggtccaggaac |