| Detail of Probeset Mtr.10430.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.10430.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC106750 /FEA=mRNA /DEF=similar to UP|RS10_ORYSA (Q9AYP4) 40S ribosomal protein S10, partial (55%) |
| Mapped public sequence ID | TC106750 |
| Gene Ontology | GO:0000028 GO:0000822 GO:0003723 GO:0003735 GO:0005515 GO:0005829 GO:0006412 GO:0006414 GO:0022627 |
| KEGG | K02947 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40244 TCMT40375 BT051301 |
| Target sequence | agggtgtatgctacgctaagaaggatttcaatttggcaaagcatccataaatcgatgtta |