| Detail of Probeset Mtr.10483.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.10483.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC106917 /FEA=mRNA /DEF=similar to UP|Q9GJT2 (Q9GJT2) Esterase D, partial (65%) |
| Mapped public sequence ID | TC106917 |
| Gene Ontology | GO:0004091 GO:0008150 GO:0016023 GO:0003674 GO:0005575 GO:0016788 |
| KEGG | K01070 K03929 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT55748 TCMT55745 TCMT55747 |
| Target sequence | tatgatgccacttctcttgtagggaagtatcccaacgtatctgccactattttgattgat |