Detail of Probeset Mtr.1068.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.1068.1.S1_at |
Species |
Medicago truncatula |
Annotation |
1519.m00028 /FEA=mRNA /DEF=AC137832.33 31018 26049 mth2-22i17 weakly similar to TAIR|gene:3438234-GOpep .1 68410.m03249 P-glyco protein -related similar to P-glycoprotein GB:A42150 from, partial (45%) |
Mapped public sequence ID |
1519.m00028 |
Gene Ontology |
GO:0005215 GO:0005524 GO:0006810 GO:0016021 GO:0042626 GO:0046581 |
KEGG |
K05658 |
Transporter |
3.A.1 3.A.1.201 3.A.1.201.1 3.A.1.201.3 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
aagtgtggtcctaaagtgtggtccatcagggaaaac |