Detail of Probeset Mtr.10710.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.10710.1.S1_at
Species Medicago truncatula
Annotation TC107668 /FEA=mRNA /DEF=similar to UP|KSG9_ARATH (Q39012) Shaggy-related protein kinase iota (ASK-iota) , partial (45%)
Mapped public sequence ID TC107668
Gene Ontology GO:0002119 GO:0005515 GO:0007052 GO:0009792 GO:0040010 GO:0040011
KEGG K00924
Transporter
Transcription Factor WRKY
Mapped unigene in the TRICHOME database TCMT53741  
Target sequence atactgtgccaagagtatgccataaggacgtgaaac