| Detail of Probeset Mtr.10852.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.10852.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC108123 /FEA=mRNA /DEF=homologue to UP|NU5C_VICFA (P15958) NAD(P)H-quinone oxidoreductase chain 5, chloroplast (NAD(P)H dehydrogenase, chain 5) (NADH-plastoquinone oxidoreductase chain 5) , partial (21%) |
| Mapped public sequence ID | TC108123 |
| Gene Ontology | GO:0016655 GO:0008137 GO:0016491 GO:0050136 |
| KEGG | K05575 K05577 |
| Transporter | 3.D.1 3.D.9 3.D.1.1.1 3.D.1.2.1 3.D.9.1.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42331 EX527871 TCMT42638 |
| Target sequence | tcatcccacttccagttcctatttttataggggtaggacttctactttttcctacggcaa |