Detail of Probeset Mtr.1101.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.1101.1.S1_at
Species Medicago truncatula
Annotation 1524.m00020 /FEA=mRNA /DEF=AC141435.28 20643 14617 mth2-21i11 weakly similar to UP|Q6ZI48 (Q6ZI48) Putative GLE1L protein
Mapped public sequence ID 1524.m00020
Gene Ontology GO:0003674 GO:0005515 GO:0005575 GO:0005643 GO:0008150
KEGG K06063 K16987
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tttgcaattgcctctgtcattgttctcattacatctcaggtcccatatgtaatggatatt
ttgctggctgagcttcacactgcctgcctttac