| Detail of Probeset Mtr.1121.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.1121.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1534.m00029 /FEA=mRNA /DEF=AC145221.15 29457 32594 mth2-36g15 weakly similar to TAIR|gene:2181376-GOpep .1 68412.m01739 expressed protein hypothetical protein T26J14.6 - Arabidopsis |
| Mapped public sequence ID | 1534.m00029 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tttcgagaaggattgcgagattcttggacgattggatacaactttttgtttttgcatttc |