| Detail of Probeset Mtr.11469.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.11469.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC110029 /FEA=mRNA /DEF=similar to GB|AAM91366.1|22137042|AY133536 At2g26990/T20P8.4 {Arabidopsis thaliana;} , partial (41%) |
| Mapped public sequence ID |
TC110029 |
| Gene Ontology |
GO:0003714 GO:0005515 GO:0005634 GO:0005737 GO:0008180 GO:0008283 GO:0016481 GO:0016564 GO:0030182 GO:0008150 |
| KEGG |
K03036 K23707 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60393 |
| Target sequence |
gttggttaaaccatactgagattatctggtgtatggattatctgttttgttgcctgactc
gcagttttgtcatgtgaattaatagaatgtaggctgtatggagttagggtgtttattaca
ctatggtggaaccgaagtgaaatccaacttgcgattcttgttttacttt |